Skip Navigation
ChemIDplus A TOXNET DATABASE LiteBrowseAdvanced

Substance Name: 5'-ACACCCAATTCTGAAAATGG-3'
RN: 104053-06-7
InChIKey: JLCPHMBAVCMARE-UHFFFAOYSA-N

Molecular Formula

  • C195-H245-N78-O114-P19

Molecular Weight

  • 6094.0185
 
* denotes mobile formatted website

Links to Resources

NLM Resources (File Locators)

Other Resources (Internet Locators)


Search for this InChIKey on the Web

Names and Synonyms

Synonyms

  • 5'-ACACCCAATTCTGAAAATGG-3'
  • ACACCCAATTCTGAAAATGG
  • ANTISENSE OLIGO TO HIV-1 5349-5368
  • Oligonucleotide

Systematic Name

  • 5'-ACACCCAATTCTGAAAATGG-3'

Registry Numbers

CAS Registry Number

  • 104053-06-7

System Generated Number

  • 0104053067

Structure Descriptors

InChI

1S/C195H245N78O114P19/c1-78-35-259(192(288)250-177(78)276)133-22-89(110(357-133)47-337-396(308,309)376-90-23-134(260-36-79(2)178(277)251-193(260)289)358-111(90)48-338-400(316,317)381-94-27-139(265-69-230-149-160(203)214-61-222-168(149)265)362-115(94)52-342-402(320,321)383-96-29-141(267-71-232-151-162(205)216-63-224-170(151)267)361-114(96)51-341-394(304,305)374-88-21-132(258-14-9-126(200)243-191(258)287)353-106(88)43-333-390(296,297)370-85-18-129(255-11-6-123(197)240-188(255)284)352-105(85)42-332-391(298,299)371-86-19-130(256-12-7-124(198)241-189(256)285)355-108(86)45-335-399(314,315)380-93-26-138(264-68-229-148-159(202)213-60-221-167(148)264)360-113(93)50-340-393(302,303)373-84-17-128(254-10-5-122(196)239-187(254)283)351-104(84)41-331-389(294,295)369-83-16-137(349-102(83)39-274)263-67-228-147-158(201)212-59-220-166(147)263)375-395(306,307)334-44-107-87(20-131(354-107)257-13-8-125(199)242-190(257)286)372-392(300,301)336-46-109-91(24-135(356-109)261-37-80(3)179(278)252-194(261)290)377-398(312,313)348-58-121-101(34-146(368-121)273-77-238-157-176(273)246-186(211)249-183(157)282)387-406(328,329)346-56-119-99(32-144(366-119)270-74-235-154-165(208)219-66-227-173(154)270)386-405(326,327)345-55-118-98(31-143(365-118)269-73-234-153-164(207)218-65-226-172(153)269)385-404(324,325)344-54-117-97(30-142(364-117)268-72-233-152-163(206)217-64-225-171(152)268)384-403(322,323)343-53-116-95(28-140(363-116)266-70-231-150-161(204)215-62-223-169(150)266)382-401(318,319)339-49-112-92(25-136(359-112)262-38-81(4)180(279)253-195(262)291)378-397(310,311)347-57-120-100(33-145(367-120)272-76-237-156-175(272)245-185(210)248-182(156)281)379-388(292,293)330-40-103-82(275)15-127(350-103)271-75-236-155-174(271)244-184(209)247-181(155)280/h5-14,35-38,59-77,82-121,127-146,274-275H,15-34,39-58H2,1-4H3,(H,292,293)(H,294,295)(H,296,297)(H,298,299)(H,300,301)(H,302,303)(H,304,305)(H,306,307)(H,308,309)(H,310,311)(H,312,313)(H,314,315)(H,316,317)(H,318,319)(H,320,321)(H,322,323)(H,324,325)(H,326,327)(H,328,329)(H2,196,239,283)(H2,197,240,284)(H2,198,241,285)(H2,199,242,286)(H2,200,243,287)(H2,201,212,220)(H2,202,213,221)(H2,203,214,222)(H2,204,215,223)(H2,205,216,224)(H2,206,217,225)(H2,207,218,226)(H2,208,219,227)(H,250,276,288)(H,251,277,289)(H,252,278,290)(H,253,279,291)(H3,209,244,247,280)(H3,210,245,248,281)(H3,211,246,249,282)

InChIKey

JLCPHMBAVCMARE-UHFFFAOYSA-N

Smiles

Cc1cn(c(=O)[nH]c1=O)C2CC(C(O2)COP(=O)(O)OC3CC(OC3COP(=O)(O)OC4CC(OC4COP(=O)(O)OC5CC(OC5COP(=O)(O)OC6CC(OC6COP(=O)(O)OC7CC(OC7COP(=O)(O)OC8CC(OC8COP(=O)(O)OC9CC(OC9COP(=O)(O)OC1CC(OC1COP(=O)(O)OC1CC(OC1COP(=O)(O)OC1CC(OC1COP(=O)(O)OC1CC(OC1CO)n1cnc2c1ncnc2N)n1ccc(nc1=O)N)n1cnc2c1ncnc2N)n1ccc(nc1=O)N)n1ccc(nc1=O)N)n1ccc(nc1=O)N)n1cnc2c1ncnc2N)n1cnc2c1ncnc2N)n1cc(c(=O)[nH]c1=O)C)n1cc(c(=O)[nH]c1=O)C)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)O