Skip Navigation
ChemIDplus A TOXNET DATABASE LiteBrowseAdvanced

Substance Name: 2NH2(C3) oligonucleotide
RN: 130237-37-5
InChIKey: JLAQMYUBJFVBIC-UHFFFAOYSA-N

Molecular Formula

  • C214-H278-N82-O133-P22

Molecular Weight

  • 6808.4192
 
* denotes mobile formatted website

Links to Resources

NLM Resources (File Locators)

Other Resources (Internet Locators)


Search for this InChIKey on the Web

Names and Synonyms

Results Name

  • 2NH2(C3) oligonucleotide

Synonyms

  • 1,2-Diaminopropane oligonucleotide(pTGGCGTACTCACCAGTCGCCGC)
  • 2NH2(C3) oligonucleotide

Systematic Name

  • DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen (2-aminopropyl)phosphoramidate)

Registry Numbers

CAS Registry Number

  • 130237-37-5

System Generated Number

  • 0130237375

Structure Descriptors

InChI

1S/C214H278N82O133P22/c1-85-47-284(211(317)271-186(85)298)152-33-99(113(396-152)52-365-430(321,322)249-46-89(5)215)417-440(341,342)384-70-131-111(45-164(406-131)296-84-248-173-185(296)264-201(233)270-195(173)307)429-451(363,364)386-72-133-108(42-161(408-133)293-81-245-170-182(293)261-198(230)267-192(170)304)426-447(355,356)374-60-121-98(32-151(395-121)283-23-14-142(224)258-210(283)316)416-439(339,340)383-69-130-109(43-162(405-130)294-82-246-171-183(294)262-199(231)268-193(171)305)427-448(357,358)377-63-124-102(36-155(399-124)287-50-88(4)189(301)274-214(287)320)420-443(347,348)380-66-127-104(38-157(402-127)289-77-241-166-175(226)235-74-238-178(166)289)423-445(351,352)372-58-119-93(27-146(393-119)278-18-9-137(219)253-205(278)311)411-434(329,330)375-61-122-100(34-153(397-122)285-48-86(2)187(299)272-212(285)318)418-441(343,344)369-55-116-96(30-149(390-116)281-21-12-140(222)256-208(281)314)413-436(333,334)378-64-125-103(37-156(400-125)288-76-240-165-174(225)234-73-237-177(165)288)422-444(349,350)371-57-118-91(25-144(392-118)276-16-7-135(217)251-203(276)309)409-432(325,326)367-53-114-94(28-147(388-114)279-19-10-138(220)254-206(279)312)412-435(331,332)379-65-126-105(39-158(401-126)290-78-242-167-176(227)236-75-239-179(167)290)424-450(361,362)385-71-132-110(44-163(407-132)295-83-247-172-184(295)263-200(232)269-194(172)306)428-449(359,360)376-62-123-101(35-154(398-123)286-49-87(3)188(300)273-213(286)319)419-442(345,346)370-56-117-97(31-150(391-117)282-22-13-141(223)257-209(282)315)415-438(337,338)382-68-129-107(41-160(404-129)292-80-244-169-181(292)260-197(229)266-191(169)303)425-446(353,354)373-59-120-92(26-145(394-120)277-17-8-136(218)252-204(277)310)410-433(327,328)368-54-115-95(29-148(389-115)280-20-11-139(221)255-207(280)313)414-437(335,336)381-67-128-106(40-159(403-128)291-79-243-168-180(291)259-196(228)265-190(168)302)421-431(323,324)366-51-112-90(297)24-143(387-112)275-15-6-134(216)250-202(275)308/h6-23,47-50,73-84,89-133,143-164,297H,24-46,51-72,215H2,1-5H3,(H,323,324)(H,325,326)(H,327,328)(H,329,330)(H,331,332)(H,333,334)(H,335,336)(H,337,338)(H,339,340)(H,341,342)(H,343,344)(H,345,346)(H,347,348)(H,349,350)(H,351,352)(H,353,354)(H,355,356)(H,357,358)(H,359,360)(H,361,362)(H,363,364)(H2,216,250,308)(H2,217,251,309)(H2,218,252,310)(H2,219,253,311)(H2,220,254,312)(H2,221,255,313)(H2,222,256,314)(H2,223,257,315)(H2,224,258,316)(H2,225,234,237)(H2,226,235,238)(H2,227,236,239)(H2,249,321,322)(H,271,298,317)(H,272,299,318)(H,273,300,319)(H,274,301,320)(H3,228,259,265,302)(H3,229,260,266,303)(H3,230,261,267,304)(H3,231,262,268,305)(H3,232,263,269,306)(H3,233,264,270,307)

InChIKey

JLAQMYUBJFVBIC-UHFFFAOYSA-N

Smiles

Cc1cn(c(=O)[nH]c1=O)C2CC(C(O2)COP(=O)(NCC(C)N)O)OP(=O)(O)OCC3C(CC(O3)n4cnc5c4nc([nH]c5=O)N)OP(=O)(O)OCC6C(CC(O6)n7cnc8c7nc([nH]c8=O)N)OP(=O)(O)OCC9C(CC(O9)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)O