Skip Navigation
ChemIDplus A TOXNET DATABASE LiteBrowseAdvanced

Substance Name: MeClEtNBzNH2 oligonucleotide
RN: 130237-39-7
InChIKey: JIRSDPVQSNHPTH-UHFFFAOYSA-N

Molecular Formula

  • C221-H283-Cl-N82-O133-P22

Molecular Weight

  • 6932.9887
 
* denotes mobile formatted website

Links to Resources

NLM Resources (File Locators)

Other Resources (Internet Locators)


Search for this InChIKey on the Web

Names and Synonyms

Results Name

  • MeClEtNBzNH2 oligonucleotide

Synonyms

  • 4-(N-Methyl-N-(2-chloroethyl)amino)-benzylamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC)
  • MeClEtNBzNH2 oligonucleotide

Systematic Name

  • DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen ((4-((2-chloroethyl)methylamino)phenyl)methyl)phosphoramidate)

Registry Numbers

CAS Registry Number

  • 130237-39-7

System Generated Number

  • 0130237397

Structure Descriptors

InChI

1S/C221H283ClN82O133P22/c1-91-53-292(218(325)278-193(91)306)159-39-106(120(404-159)58-373-438(329,330)256-52-95-6-8-96(9-7-95)282(5)29-19-222)425-448(349,350)392-76-138-118(51-171(414-138)304-90-255-180-192(304)271-208(240)277-202(180)315)437-459(371,372)394-78-140-115(48-168(416-140)301-87-252-177-189(301)268-205(237)274-199(177)312)434-455(363,364)382-66-128-105(38-158(403-128)291-28-18-149(231)265-217(291)324)424-447(347,348)391-75-137-116(49-169(413-137)302-88-253-178-190(302)269-206(238)275-200(178)313)435-456(365,366)385-69-131-109(42-162(407-131)295-56-94(4)196(309)281-221(295)328)428-451(355,356)388-72-134-111(44-164(410-134)297-83-248-173-182(233)242-80-245-185(173)297)431-453(359,360)380-64-126-100(33-153(401-126)286-23-13-144(226)260-212(286)319)419-442(337,338)383-67-129-107(40-160(405-129)293-54-92(2)194(307)279-219(293)326)426-449(351,352)377-61-123-103(36-156(398-123)289-26-16-147(229)263-215(289)322)421-444(341,342)386-70-132-110(43-163(408-132)296-82-247-172-181(232)241-79-244-184(172)296)430-452(357,358)379-63-125-98(31-151(400-125)284-21-11-142(224)258-210(284)317)417-440(333,334)375-59-121-101(34-154(396-121)287-24-14-145(227)261-213(287)320)420-443(339,340)387-71-133-112(45-165(409-133)298-84-249-174-183(234)243-81-246-186(174)298)432-458(369,370)393-77-139-117(50-170(415-139)303-89-254-179-191(303)270-207(239)276-201(179)314)436-457(367,368)384-68-130-108(41-161(406-130)294-55-93(3)195(308)280-220(294)327)427-450(353,354)378-62-124-104(37-157(399-124)290-27-17-148(230)264-216(290)323)423-446(345,346)390-74-136-114(47-167(412-136)300-86-251-176-188(300)267-204(236)273-198(176)311)433-454(361,362)381-65-127-99(32-152(402-127)285-22-12-143(225)259-211(285)318)418-441(335,336)376-60-122-102(35-155(397-122)288-25-15-146(228)262-214(288)321)422-445(343,344)389-73-135-113(46-166(411-135)299-85-250-175-187(299)266-203(235)272-197(175)310)429-439(331,332)374-57-119-97(305)30-150(395-119)283-20-10-141(223)257-209(283)316/h6-18,20-28,53-56,79-90,97-140,150-171,305H,19,29-52,57-78H2,1-5H3,(H,331,332)(H,333,334)(H,335,336)(H,337,338)(H,339,340)(H,341,342)(H,343,344)(H,345,346)(H,347,348)(H,349,350)(H,351,352)(H,353,354)(H,355,356)(H,357,358)(H,359,360)(H,361,362)(H,363,364)(H,365,366)(H,367,368)(H,369,370)(H,371,372)(H2,223,257,316)(H2,224,258,317)(H2,225,259,318)(H2,226,260,319)(H2,227,261,320)(H2,228,262,321)(H2,229,263,322)(H2,230,264,323)(H2,231,265,324)(H2,232,241,244)(H2,233,242,245)(H2,234,243,246)(H2,256,329,330)(H,278,306,325)(H,279,307,326)(H,280,308,327)(H,281,309,328)(H3,235,266,272,310)(H3,236,267,273,311)(H3,237,268,274,312)(H3,238,269,275,313)(H3,239,270,276,314)(H3,240,271,277,315)

InChIKey

JIRSDPVQSNHPTH-UHFFFAOYSA-N

Smiles

Cc1cn(c(=O)[nH]c1=O)C2CC(C(O2)COP(=O)(NCc3ccc(cc3)N(C)CCCl)O)OP(=O)(O)OCC4C(CC(O4)n5cnc6c5nc([nH]c6=O)N)OP(=O)(O)OCC7C(CC(O7)n8cnc9c8nc([nH]c9=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)O