Skip Navigation
ChemIDplus A TOXNET DATABASE LiteBrowseAdvanced

Substance Name: Octadecamine oligonucleotide
RN: 130237-40-0

Molecular Formula

  • C229-H307-N81-O133-P22

Molecular Weight

  • 7003.8063
* denotes mobile formatted website

Links to Resources

NLM Resources (File Locators)

Other Resources (Internet Locators)

Search for this InChIKey on the Web

Names and Synonyms

Results Name

  • Octadecamine oligonucleotide


  • Octadecamine oligonucleotide
  • Octadecamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC)

Systematic Name

  • DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen octadecylphosphoramidate)

Registry Numbers

CAS Registry Number

  • 130237-40-0

System Generated Number

  • 0130237400

Structure Descriptors





