Skip Navigation
ChemIDplus A TOXNET DATABASE LiteBrowseAdvanced

Substance Name: Octadecamine oligonucleotide
RN: 130237-40-0
InChIKey: OLAPHMFMQDYFCB-UHFFFAOYSA-N

Molecular Formula

  • C229-H307-N81-O133-P22

Molecular Weight

  • 7003.8063
 
* denotes mobile formatted website

Links to Resources


Search for this InChIKey on the Web

Names and Synonyms

Results Name

  • Octadecamine oligonucleotide

Synonyms

  • Octadecamine oligonucleotide
  • Octadecamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC)

Systematic Name

  • DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen octadecylphosphoramidate)

Registry Numbers

CAS Registry Number

  • 130237-40-0

System Generated Number

  • 0130237400

Structure Descriptors

InChI

1S/C229H307N81O133P22/c1-6-7-8-9-10-11-12-13-14-15-16-17-18-19-20-21-31-263-444(335,336)379-68-128-114(50-167(410-128)298-63-101(2)201(312)285-226(298)331)431-454(355,356)398-86-146-126(62-179(420-146)310-100-262-188-200(310)278-216(247)284-210(188)321)443-465(377,378)400-88-148-123(59-176(422-148)307-97-259-185-197(307)275-213(244)281-207(185)318)440-461(369,370)388-76-136-113(49-166(409-136)297-40-30-157(238)272-225(297)330)430-453(353,354)397-85-145-124(60-177(419-145)308-98-260-186-198(308)276-214(245)282-208(186)319)441-462(371,372)391-79-139-117(53-170(413-139)301-66-104(5)204(315)288-229(301)334)434-457(361,362)394-82-142-119(55-172(416-142)303-93-255-181-190(240)249-90-252-193(181)303)437-459(365,366)386-74-134-108(44-161(407-134)292-35-25-152(233)267-220(292)325)425-448(343,344)389-77-137-115(51-168(411-137)299-64-102(3)202(313)286-227(299)332)432-455(357,358)383-71-131-111(47-164(404-131)295-38-28-155(236)270-223(295)328)427-450(347,348)392-80-140-118(54-171(414-140)302-92-254-180-189(239)248-89-251-192(180)302)436-458(363,364)385-73-133-106(42-159(406-133)290-33-23-150(231)265-218(290)323)423-446(339,340)381-69-129-109(45-162(402-129)293-36-26-153(234)268-221(293)326)426-449(345,346)393-81-141-120(56-173(415-141)304-94-256-182-191(241)250-91-253-194(182)304)438-464(375,376)399-87-147-125(61-178(421-147)309-99-261-187-199(309)277-215(246)283-209(187)320)442-463(373,374)390-78-138-116(52-169(412-138)300-65-103(4)203(314)287-228(300)333)433-456(359,360)384-72-132-112(48-165(405-132)296-39-29-156(237)271-224(296)329)429-452(351,352)396-84-144-122(58-175(418-144)306-96-258-184-196(306)274-212(243)280-206(184)317)439-460(367,368)387-75-135-107(43-160(408-135)291-34-24-151(232)266-219(291)324)424-447(341,342)382-70-130-110(46-163(403-130)294-37-27-154(235)269-222(294)327)428-451(349,350)395-83-143-121(57-174(417-143)305-95-257-183-195(305)273-211(242)279-205(183)316)435-445(337,338)380-67-127-105(311)41-158(401-127)289-32-22-149(230)264-217(289)322/h22-30,32-40,63-66,89-100,105-148,158-179,311H,6-21,31,41-62,67-88H2,1-5H3,(H,337,338)(H,339,340)(H,341,342)(H,343,344)(H,345,346)(H,347,348)(H,349,350)(H,351,352)(H,353,354)(H,355,356)(H,357,358)(H,359,360)(H,361,362)(H,363,364)(H,365,366)(H,367,368)(H,369,370)(H,371,372)(H,373,374)(H,375,376)(H,377,378)(H2,230,264,322)(H2,231,265,323)(H2,232,266,324)(H2,233,267,325)(H2,234,268,326)(H2,235,269,327)(H2,236,270,328)(H2,237,271,329)(H2,238,272,330)(H2,239,248,251)(H2,240,249,252)(H2,241,250,253)(H2,263,335,336)(H,285,312,331)(H,286,313,332)(H,287,314,333)(H,288,315,334)(H3,242,273,279,316)(H3,243,274,280,317)(H3,244,275,281,318)(H3,245,276,282,319)(H3,246,277,283,320)(H3,247,278,284,321)

InChIKey

OLAPHMFMQDYFCB-UHFFFAOYSA-N

Smiles

CCCCCCCCCCCCCCCCCCNP(=O)(O)OCC1C(CC(O1)n2cc(c(=O)[nH]c2=O)C)OP(=O)(O)OCC3C(CC(O3)n4cnc5c4nc([nH]c5=O)N)OP(=O)(O)OCC6C(CC(O6)n7cnc8c7nc([nH]c8=O)N)OP(=O)(O)OCC9C(CC(O9)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1ncnc2N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1cc(c(=O)[nH]c1=O)C)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)OP(=O)(O)OCC1C(CC(O1)n1cnc2c1nc([nH]c2=O)N)OP(=O)(O)OCC1C(CC(O1)n1ccc(nc1=O)N)O