Skip Navigation
ChemIDplus A TOXNET DATABASE LiteBrowseAdvanced

Substance Name: Cholesteryl oligonucleotide
RN: 136088-27-2

Molecular Formula

  • C238-H314-N80-O134-P22
 
* denotes mobile formatted website

Links to Resources

NLM Resources (File Locators)

Other Resources (Internet Locators)

Names and Synonyms

Results Name

  • Cholesteryl oligonucleotide

Synonyms

  • Cholesteryl oligonucleotide
  • Cholesteryl oligonucleotide(pTGGCGTACTCACCAGTCGCCGC)

Systematic Name

  • DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-((3beta)-cholest-5-en-3-yl hydrogen phosphate)

Registry Numbers

CAS Registry Number

  • 136088-27-2

System Generated Number

  • 0136088272