Skip Navigation
ChemIDplus A TOXNET DATABASE LiteBrowseAdvanced

Substance Name: Cholesteryl oligonucleotide
RN: 136088-27-2
InChIKey: QYCQTGCSZHSERP-UWJAVNAUSA-N

Molecular Formula

  • C238-H314-N80-O134-P22

Molecular Weight

  • 7120.9526
 
* denotes mobile formatted website

Links to Resources

NLM Resources (File Locators)

Other Resources (Internet Locators)


Search for this InChIKey on the Web

Names and Synonyms

Results Name

  • Cholesteryl oligonucleotide

Synonyms

  • Cholesteryl oligonucleotide
  • Cholesteryl oligonucleotide(pTGGCGTACTCACCAGTCGCCGC)

Systematic Name

  • DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-((3beta)-cholest-5-en-3-yl hydrogen phosphate)

Registry Numbers

CAS Registry Number

  • 136088-27-2

System Generated Number

  • 0136088272

Structure Descriptors

InChI

1S/C238H314N80O134P22/c1-100(2)11-10-12-101(3)109-15-16-110-108-14-13-106-39-107(17-28-237(106,8)111(108)18-29-238(109,110)9)431-453(343,344)388-67-143-121(49-174(418-143)306-62-102(4)208(320)293-233(306)339)440-466(369,370)406-85-153-133(61-186(428-153)318-99-271-195-207(318)286-223(256)292-217(195)329)452-474(385,386)408-87-155-130(58-183(430-155)315-96-268-192-204(315)283-220(253)289-214(192)326)449-470(377,378)396-75-142-120(48-173(417-142)305-38-27-164(247)280-232(305)338)439-462(361,362)405-84-152-131(59-184(427-152)316-97-269-193-205(316)284-221(254)290-215(193)327)450-471(379,380)399-78-146-124(52-177(421-146)309-65-105(7)211(323)296-236(309)342)443-465(367,368)402-81-149-126(54-179(424-149)311-92-264-188-197(249)258-89-261-200(188)311)446-468(373,374)394-73-140-115(43-168(415-140)300-33-22-159(242)275-227(300)333)434-457(351,352)397-76-144-122(50-175(419-144)307-63-103(5)209(321)294-234(307)340)441-463(363,364)391-70-137-118(46-171(412-137)303-36-25-162(245)278-230(303)336)436-459(355,356)400-79-147-125(53-178(422-147)310-91-263-187-196(248)257-88-260-199(187)310)445-467(371,372)393-72-139-113(41-166(414-139)298-31-20-157(240)273-225(298)331)432-455(347,348)389-68-135-116(44-169(410-135)301-34-23-160(243)276-228(301)334)435-458(353,354)401-80-148-127(55-180(423-148)312-93-265-189-198(250)259-90-262-201(189)312)447-473(383,384)407-86-154-132(60-185(429-154)317-98-270-194-206(317)285-222(255)291-216(194)328)451-472(381,382)398-77-145-123(51-176(420-145)308-64-104(6)210(322)295-235(308)341)442-464(365,366)392-71-138-119(47-172(413-138)304-37-26-163(246)279-231(304)337)438-461(359,360)404-83-151-129(57-182(426-151)314-95-267-191-203(314)282-219(252)288-213(191)325)448-469(375,376)395-74-141-114(42-167(416-141)299-32-21-158(241)274-226(299)332)433-456(349,350)390-69-136-117(45-170(411-136)302-35-24-161(244)277-229(302)335)437-460(357,358)403-82-150-128(56-181(425-150)313-94-266-190-202(313)281-218(251)287-212(190)324)444-454(345,346)387-66-134-112(319)40-165(409-134)297-30-19-156(239)272-224(297)330/h13,19-27,30-38,62-65,88-101,107-155,165-186,319H,10-12,14-18,28-29,39-61,66-87H2,1-9H3,(H,343,344)(H,345,346)(H,347,348)(H,349,350)(H,351,352)(H,353,354)(H,355,356)(H,357,358)(H,359,360)(H,361,362)(H,363,364)(H,365,366)(H,367,368)(H,369,370)(H,371,372)(H,373,374)(H,375,376)(H,377,378)(H,379,380)(H,381,382)(H,383,384)(H,385,386)(H2,239,272,330)(H2,240,273,331)(H2,241,274,332)(H2,242,275,333)(H2,243,276,334)(H2,244,277,335)(H2,245,278,336)(H2,246,279,337)(H2,247,280,338)(H2,248,257,260)(H2,249,258,261)(H2,250,259,262)(H,293,320,339)(H,294,321,340)(H,295,322,341)(H,296,323,342)(H3,251,281,287,324)(H3,252,282,288,325)(H3,253,283,289,326)(H3,254,284,290,327)(H3,255,285,291,328)(H3,256,286,292,329)/t101-,107+,108-,109-,110+,111+,112?,113?,114?,115?,116?,117?,118?,119?,120?,121?,122?,123?,124?,125?,126?,127?,128?,129?,130?,131?,132?,133?,134?,135?,136?,137?,138?,139?,140?,141?,142?,143?,144?,145?,146?,147?,148?,149?,150?,151?,152?,153?,154?,155?,165?,166?,167?,168?,169?,170?,171?,172?,173?,174?,175?,176?,177?,178?,179?,180?,181?,182?,183?,184?,185?,186?,237+,238-/m1/s1

InChIKey

QYCQTGCSZHSERP-UWJAVNAUSA-N

Smiles

CC(C)CCC[C@@H](C)[C@H]1CC[C@H]2[C@H]3CC=C4C[C@H](CC[C@]4(C)[C@H]3CC[C@]12C)OP(=O)(O)OCC5OC(CC5OP(=O)(O)OCC6OC(CC6OP(=O)(O)OCC7OC(CC7OP(=O)(O)OCC8OC(CC8OP(=O)(O)OCC9OC(CC9OP(=O)(O)OCC%10OC(CC%10OP(=O)(O)OCC%11OC(CC%11OP(=O)(O)OCC%12OC(CC%12OP(=O)(O)OCC%13OC(CC%13OP(=O)(O)OCC%14OC(CC%14OP(=O)(O)OCC%15OC(CC%15OP(=O)(O)OCC%16OC(CC%16OP(=O)(O)OCC%17OC(CC%17OP(=O)(O)OCC%18OC(CC%18OP(=O)(O)OCC%19OC(CC%19OP(=O)(O)OCC%20OC(CC%20OP(=O)(O)OCC%21OC(CC%21OP(=O)(O)OCC%22OC(CC%22OP(=O)(O)OCC%23OC(CC%23OP(=O)(O)OCC%24OC(CC%24OP(=O)(O)OCC%25OC(CC%25OP(=O)(O)OCC%26OC(CC%26O)N%27C=CC(=NC%27=O)N)n%28cnc%29C(=O)NC(=Nc%28%29)N)N%30C=CC(=NC%30=O)N)N%31C=CC(=NC%31=O)N)n%32cnc%33C(=O)NC(=Nc%32%33)N)N%34C=CC(=NC%34=O)N)N%35C=C(C)C(=O)NC%35=O)n%36cnc%37C(=O)NC(=Nc%36%37)N)n%38cnc%39c%38ncnc%39N)N%40C=CC(=NC%40=O)N)N%41C=CC(=NC%41=O)N)n%42cnc%43c%42ncnc%43N)N%44C=CC(=NC%44=O)N)N%45C=C(C)C(=O)NC%45=O)N%46C=CC(=NC%46=O)N)n%47cnc%48c%47ncnc%48N)N%49C=C(C)C(=O)NC%49=O)n%50cnc%51C(=O)NC(=Nc%50%51)N)N%52C=CC(=NC%52=O)N)n%53cnc%54C(=O)NC(=Nc%53%54)N)n%55cnc%56C(=O)NC(=Nc%55%56)N)N%57C=C(C)C(=O)NC%57=O